FASTA Contigs — One Line Per Record (.fasta)
The same four contigs written one sequence per line rather than wrapped, which is how many pipelines emit FASTA and how many line-oriented parsers assume it always looks. Comparing against the wrapped twin proves a parser joins continuation lines instead of taking the first one.
>NXCTG01 length=600
GGCGCGCACGTGGGGGCCCCCAAAAAGCTCTAATGGACTGAATATTGGGGCGTTCTGATAACCGGAGTCGTGATTCTGACGTGACTGCACACATCGATGGGCGGTTTCCTCCATGAGTTGAACTATCTTAGATAAGAGTAGACGAGAGCAACCAGACTACTTGTTGTGGGCTGCGAGGACACCGGAAATCTTCGCTGATTTTGCCCTAATGGTTGCTTCAGTGTCTACGCTCGTCACGCTAGCGACAGATATAGCTTACCGCCGCGGCTATAAGCAAAGTGTGTCAACGAACGGCTTTCTAGCGCAATAATCTGAAGCAGGGGTATTACAACAAAGAGTACTCGCGGGGGACACTCGATCCAAGAGCATGGGCCCAATCCGTTGATTACTGAGCTTCATCGGATCCATTAACCGTCGGGTCTGCTATACTATCGCGTAGATCGAAGGTCTGTGCGTTGCCCTATGTGCAAACCGAATCTGACGGCAAGCCGAAAAGATATTATTGATTGATCTTACATTCGATCGGTTCGCAGACCCGAGTTCAATGCGTGGTCAAATGTCTACATCAGAAACCGGTGGCTACACGAGCTAAGAATTGGG
>NXCTG02 length=600
ACCCGCAGTTTGGAGTGCCTAGCGACTAATGTGACACTGTGGTATCGCTCCTTCTTAGGAGGCAGGGACTCCAGCGTCTCTTTGCGTGTGGCTATAGAATTGTATAATATCCCGTCGCGGAGAACAAGCTTTCATAGGCCGGTGTGGCATCGTTCTCCAACAGACGCAGTGTTGCTTCCATTCGGTTGCCGGAGAGCTAGTAGTACCACTGCGATTCTACTTCACTTCTTGCGTGTGCATCTGTAAGATCCGGTCGGGCCAGGTATGCAAGGTACCGTATACCCCGTGGCTCGCGACATCCCAACGTCCCATAGACGCCTTCGTCAAGACTCCCCGGTTCAATACAGTCTGAGAAATTTCGACGCTTCGCCCGTGCGCGGCTAGAGGAGCCTGGTCTAGTATACGTGCATCGCACGAACGGCGCGAGACGGCGGACACATACAACGTTTAGAACCATGCGAAACCTCCTCTAAAGAGGGCGTAAAAGCTGGGGAGATGGCACCGAAGAGTTACTGACCGTATGGGCCATGCAAATCTTCAGTAGACTGATTTTAACCAGGGAATCACGATGGACTCATACCATACGGCTTCATGTAAACC
>NXCTG03 length=600
AACGGGGGCGGCTTTAATGTCTGGTTTAAGCTACAGGAGGTGGGCATTCACACCGACGACAGACCTCATTGCCAGCCTCCCTGACGATTACATAGCCACGTTTAACTTGTTTGTTTGGTTGTTCATACTCCACCAGTTGCACAGACCGGAGCTACCCGTGCGACTCCGAGGCATGAAGCATAAATGCCTCAGGTGAAGTAGTCACCTTGAACGGCTAGTATGTCGATCGATAGACTTCGCGCGTGGGGCGATAGGACCCGCACTGGATTATTAGTTCGCACGCTGGGTTAAGTAATCCTCACAGTGATAAGGCGGGACCGCTTCCTGTTAGATTGGCAGACAGTGATTTGCAGAACCTCTGGAATCGAAGTAGAAGGAAGTGCCTGTTGTCGAGAAGAGGATGGTCCGAGGGGCTAGTGATAGGGACATACAGGTCGTCGGGCCACACATAAGTTATGTTCGTTACCCTTGGAAAGTAGAATCACGGCGTATATCACATTGTTATTACATAAAATAATGCCGGTGGAACGCGATCCTTAAGACAGGGGCAGCCAAAGCTGGGAGTAAAGCAATCACATTTAACGAAATGTCGTGGACGTA
>NXCTG04 length=600
TACAACATAGACGATGCATAGAATTGCACCAGAGCAGTCAAACTTGAAAGATTGACCGAGCCTCACGGGGGAATAACCTCCGGTCCACAGCGGGCCAGTAACGGTCATCGATTGATGGGTCTAGCACCACAACAACGGTGGTTAGTTCTTAGCAATTGCGATTTGAGAACGGAACTAGTTATTCAAATCTTTTCCCGTCCTATCGTAGCAGACCTTCTACAGACACTGTTGTACACAATGGGTTTGGATTCGTCCCACATCCGTTACGACTGGATGGCATCTGATGGTGATGAACCTACGACAAGGGATGCTAATGCCCTAGCATGACTGGTTAAACAACTTAGTAGATAATCGTTTCCGCTCTCTTTTTGCTAGGGGACAACAGGTTATTGAGAAGAGTCTGGGTTCATTTTCGATCCGCCGATCGATTGGTAGACTAGCCAACGGGACTACGCACGCCGTCCGGGTAATTAAGCTAATGCACATGCCAGTTGTTAAATCAAACACATAGCCGCCCGGAACGTAGCAGCTTACTTAAGGTCGATAGTCAGTGCGGTAACCTGTGACAACCTATTCTCGGCGGCGTTTGTGGAGGATCGT
Specifications
- Records
- 4
- Sequence Length
- 600
- Line Width
- unwrapped (600)
- Identical Sequences To
- the 60-column twin
- Longest Line
- 600
Testing contract
Expected to pass- Scenario
- Parse both this file and the 60-column twin and compare the sequences record by record.
- Expected result
- All four sequences are identical between the two files, and a parser that reads only the first sequence line returns 60 bases from the wrapped twin and 600 from this one.
What is a .fasta file?
FASTA is the plain-text format for biological sequences. Each record begins with a `>` header line carrying an identifier and free-form description, followed by the sequence itself wrapped over as many lines as needed using IUPAC single-letter codes for nucleotides or amino acids. It records no quality or alignment information, which is what keeps it universal.
How to use this file
Use an example .fasta file to test sequence parsers and pipeline entry points, checking multi-record splitting, tolerance of varying line widths and blank lines, correct handling of ambiguity codes, and that description text after the first whitespace is kept separate from the identifier.
How to use this file for testing
“FASTA Contigs — One Line Per Record (.fasta)” is a deterministic Novus Examples fixture for Scientific data, Editor testing, Conversion testing. Citation catalogs (BibTeX, RIS), chemistry structures (MDL Molfile, PDB), and gridded binary data (NetCDF, FITS) — for testing reference managers, molecule viewers, and scientific-data loaders.
Documented properties for this file: 4 records. Compare results against paired or grouped companions on this page when present (clean↔damaged, searchable↔scanned, or format twins) so scores stay reproducible across runs.
Download the file once, keep the path stable in CI or local scripts, and treat the spec table as the contract: dimensions, seeds, field lists, and roles are intentional. Corrupt or invalid samples are labelled as such — expect parsers to fail loudly rather than silently accept them.
Scientific fixtures are small, valid, and fully synthetic — no real organism, patient, sample, or observation. Point your parser or loader at the file and check it reads the documented records, variables, or headers; binary formats ship a readable twin or metadata listing for comparison.
Related files
- csvFASTQ Quality Score Reference — Both Encodings Decoded (.csv)Every twelfth base of the six reads with its Phred score, the ASCII character it takes under both offsets, and the error probability that score implies. It converts a quality-encoding argument into a lookup you can diff.
- fastqFASTQ Reads — Phred+64 Legacy Encoding (.fastq)The identical reads and identical quality scores written with the legacy Phred+64 offset used by older Illumina pipelines. Decode it with the modern offset and every base looks 31 points better than it is, which is a silent quality inflation rather than a parse failure.
- csvGenomic Coordinate Conventions — BED versus GFF3 Side by Side (.csv)Every interval written in both coordinate conventions with its length, which is identical either way. It is the lookup table for the most common bioinformatics off-by-one, and the length column is what proves a conversion did not quietly change an interval's size.
- nwkNewick Tree — Topology Only, No Branch Lengths (.nwk)The identical tree topology with every branch length and support value stripped, which is what a Newick writer produces when the source tree has no lengths. Comparing the two proves a parser distinguishes 'length zero' from 'no length recorded'.
- csvSAM CIGAR Span Reference — Query versus Reference Length (.csv)Each alignment's CIGAR decomposed into how many query bases and how many reference bases it consumes, with the resulting 1-based reference end. The three records where those numbers differ are the whole reason CIGAR arithmetic is worth testing.
- csvChemistry Fixture Molecule Index (.csv)One row per molecule used across the chemistry fixtures, with formula, molecular weight, SMILES and the atom and bond counts each file should yield. It is the oracle a cheminformatics toolkit can be scored against without needing a second toolkit to generate the answers.
Generated by generation/scientific.py. Free for any use, no attribution required — license.